Oxidative stress reactivates androgen receptor signaling via USP36 to drive castration resistance in prostate cancer

Prostate cancer (PCa), a malignancy originating from prostate tissue, remains a leading cause of cancer-related mortality among men worldwide. As an androgen-dependent disease, PCa is commonly treated with androgen deprivation therapy (ADT), which reduces serum androgen levels and suppresses androgen receptor (AR) signaling, typically with initial efficacy¹. However, disease relapse frequently occurs, and patients often progress to metastatic castration-resistant prostate cancer (CRPC)². A key mechanism underlying CRPC development is the persistent activation of AR in a ligand-independent manner³. Although significant advances have been made in understanding AR reactivation in CRPC, the specific molecular pathways, particularly those related to oxidative stress, warrant further investigation.

Initial research on oxidative stress and reactive oxygen species (ROS) focused on their harmful effects on cellular macromolecules, including DNA, proteins, and lipids. However, contemporary studies have shown that oxidative stress and ROS also function as signaling molecules that regulate diverse cellular behaviors⁴. Oxidative stress can aggravate tumor progression by inducing tumor cell proliferation, survival, and adaptation to hypoxia⁵. Notably, ADT has been shown to trigger oxidative stress in PCa⁶, and both ROS and oxidative stress are closely related to PCa progression and CRPC development, partly through the activation of AR signaling⁶. For instance, TXNDC9 has been identified as a key regulator of ROS levels, and the TXNDC9–PRDX1 pathway contributes significantly to ROS-mediated AR activation⁷. Additionally, Sharifi et al. demonstrated that reduced SOD2 expression leads to AR reactivation in CRPC by elevating ROS⁸. Despite these insights, the precise mechanisms by which oxidative stress drives AR reactivation are still not fully understood.

Previous reports indicate that treatment with 10 μM H₂O₂ elevates nuclear AR levels and promotes androgen resistance in PCa cells⁹. In the present study, we employed both the hormone-responsive LNCaP cell line and the CRPC-derived 22RV1 cell line to investigate the mechanisms through which oxidative stress, simulated by H₂O₂ exposure, influences AR–prostate-specific antigen (PSA) signaling and promotes androgen resistance. The use of these two PCa cell lines enabled us to assess the relevance of oxidative stress-induced AR activation in different phenotypes of PCa.

Cell culture and drug treatment

LNCaP (Cat No. CL-0143) and 22RV1 (Cat No. CL-0004) cells (Procell, Wuhan, China) were maintained in low-glucose DMEM (Cat No. G4520–500ML; Servicebio, Wuhan, China) supplemented with 10% FBS (Cat No. 11011–8611; Solarbio, Beijing, China) in a humidified incubator (Thermo Fisher Scientific, Waltham, MA, USA). H₂O₂ was obtained from Shanghai Macklin Biochemical Technology (Macklin, Shanghai, China), and cycloheximide (CHX) was obtained from Selleck (Shanghai, China).

Cell counting kit 8 assay

Cell Counting Kit 8 (CCK8) assay (Cat No. C0041; Beyotime, Shanghai, China) was used to assess the cytotoxicity of H₂O₂ at different concentrations (0, 5, 10, 20, 40, 80, 160, and 320 μM). Briefly, PCa cells were seeded in a 96-well plate at a density of 5000 cells/well and treated with H₂O₂ for 24 h. Subsequently, CCK8 reagent was added to each well. After 4 h, the optical density (OD) was measured at the wavelength of 450 nm.

ROS activity analysis

ROS activity was assessed using a commercial ROS detection kit (Cat No. S0033S; Beyotime). Briefly, PCa cells were seeded in 6-well plates at a density of 100,000 cells/well and cultured overnight. The following day, H₂O₂ was added to each well and the cells were incubated for 24 h. DCFH-DA was diluted to 10 μmol/L at a ratio of 1:1000. The culture supernatant was discarded, and the cells were incubated with DCFH-DA for 20 min at 37 °C. The unbound probe was removed by washing the cells with a serum-free medium three times. Subsequently, the mean fluorescence intensity of ROS was evaluated to quantify intracellular ROS levels.

Western blotting

PCa cells were seeded in 6-well plates at a density of 500,000 cells/well. After 24 h of treatment with H₂O₂, the cells were washed with PBS, lysed with radioimmunoprecipitation assay (RIPA) buffer (Cat No. P0013D; Beyotime), and centrifuged at 12,000 × g for 15 min at 4 °C. The supernatants were collected as total protein extracts, and a Bradford protein assay kit (Cat No. G2001-250ML; Servicebio) was used to quantify the extracted proteins. A total of 30 μg of protein per lane was separated via sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) at 150 V for 1.5 h. The separated proteins were transferred to a PVDF membrane. After non-specific binding sites were blocked, the membrane was sequentially incubated with diluted primary and secondary antibodies. Subsequently, protein bands were visualized using an ECL kit, and the proteins were quantified using the ImageJ software (NIH, Bethesda, MD, USA). The following primary antibodies were used: anti-AR (Cat No. 66747-1-Ig; AB_2882094; Proteintech, Wuhan, China), anti-AR-V7 (Cat No. 19672, Cell Signaling Technology), anti-PSA (Cat No. 10501-1-AP; AB_2172597; Proteintech, Wuhan, China), anti-ubiquitin-specific peptidase 36 (anti-USP36) (Cat No. 14783-1-AP; AB_2213357; Proteintech, Wuhan, China), anti-Ub (Cat No. 10201-2-AP; AB_671515; Proteintech, Wuhan, China), and anti-β-actin (Cat No. GB15003; AB_3083699; Servicebio).

qRT-PCR

Total RNA was isolated from PCa cells using Trizol (Cat No. R0016; Beyotime). Reverse transcription was performed using the SweScript RT II First Strand cDNA Synthesis Kit (With gDNA Remover) (Cat No. G3333; Servicebio). Subsequently, qPCR was performed using the ArtiCanATM SYBR qPCR Mix (Cat No. TSE501; Tsingke, Beijing, China) on a fluorescent quantitative PCR instrument (ABI). The following primer sequences were used to amplify PSA: forward, 5’‐GCTGGGAGTGCGAGAAGCAT‐3’; reverse, 5’‐CGTAGAGCGGGTGTGGGAAG‐3’. β-actin was used as the internal reference gene, and the relative mRNA expression level of PSA was calculated using the 2^−ΔΔCt method¹⁰.

Dual-luciferase reporter assay

The sequence of PSA promoter was amplified using qRT-PCR and inserted into the downstream region of the pGL3-basic vector (Miaoling Biotechnology). PCa cells (LNCaP and 22RV1) were transfected with the PSA-encoding vector using Lipofectamine 3000 reagent followed by indicated treatments. After 24 h of H₂O₂ exposure, luciferase activity was evaluated using a luciferase reporter assay kit (Cat No. RG029S; Beyotime) on a GloMax 20/20 Luminometer (Promega), with pRL-TK (Miaoling Biotechnology) serving as the reference. Firefly luciferase activity was normalized to Renilla luciferase activity for each sample.

TurboID-mediated proximity biotin labeling

LNCaP cells were seeded in 10-cm plates at a density of approximately 3 × 10⁶ cells/plate. Upon reaching 70% confluence, the cells were transfected with the pLV3-CMV-AR(human)-EGFP-TurboID-NLS-3 × FLAG-Puro plasmid for 24 h, followed by an additional incubation of 24 h with or without 20-μM H₂O₂. Subsequently, the cells were incubated with 100-μM biotin for 1 h and collected. The cells were washed twice with ice-cold PBS to remove excess biotin, lysed with RIPA buffer for 30 min, and centrifuged. The supernatants were collected as total protein extracts. A total of 50 μL of streptavidin beads were washed thrice with 1 × TBS and separated on a magnetic stand. The beads were incubated with the extracted proteins for 12 at 4 °C with constant shaking. The beads were separated on the magnetic stand and washed thrice with a wash buffer. Subsequently, biotinylated proteins were eluted by incubating the beads with 5 × SDS loading buffer in a boiling water bath for 10 min.

Biotin labeling efficiency analysis: The eluted proteins were separated via SDS-PAGE and transferred to a PVDF membrane. After non-specific binding sites were blocked, the membrane was incubated with HRP-labeled streptavidin antibody for 1 h. Subsequently, the membrane was washed with 1 × TBST five times and protein bands were visualized using an ECL reagent.

Silver staining: The eluted proteins were separated via SDS-PAGE and subjected to silver staining using a standard protocol.

MS: MS was used to identify biotin-labeled proteins.

GO functional annotation: GO enrichment analysis was implemented using the DAVID database (https://david.ncifcrf.gov/).

Cell transfection

The pEnCMV-USP36(human)-3 × Myc plasmid (Miaolingbio, Wuhan, China) was used to overexpress USP36, whereas the pEnCMV empty vector (without target sequences) was used as the negative control. A FLAG tag was purchased from Solarbio (Cat No. P02839) to construct an AR-FLAG overexpression plasmid. An HA tag was purchased from Proteintech (Cat No. 51064-2-AP) to construct a Ub-HA overexpression plasmid. ShNC and shUSP36 were purchased from Tsingke (Beijing, China). Cell transfection was performed using lipo6000™ transfection reagent (Cat No. C0526; Beyotime).

Co-immunoprecipitation

For co-immunoprecipitation (Co-IP), PCa cells were seeded in 6-well plates at a density of 500,000 cells/well. To analyze the binding between exogenously expressed AR and USP36, the cells were co-transfected with the AR-Flag and pEnCMV-USP36(human)-3 × Myc plasmids. After 24 h of treatment with H₂O₂ (20 μM), the cells were lysed and incubated with an anti-FLAG antibody (Cat No. K200001m; Solarbio). Subsequently, the cells were incubated with BeyoMag™ Protein A + G beads (Cat No. P2108; Beyotime) for 1 h at 4 °C. The beads were washed with the lysis buffer 3 times, and the eluted proteins were analyzed using western blotting.

To validate the binding between endogenous USP36 and AR, PCa cells were exposed to H₂O₂, lysed, and incubated with an anti-USP36 polyclonal antibody (Cat No. 14783-1-AP; Proteintech) for IP. Subsequently, the cells were incubated with BeyoMag™ Protein A + G beads (Cat No. P2108; Beyotime) for 1 h at 4 °C. The beads were washed with the lysis buffer 3 times, and the eluted proteins were analyzed using western blotting.

Immunofluorescence assay

After indicated treatments, PCa cells were immobilized with 4% paraformaldehyde and permeabilized with 0.1% Triton. After non-specific binding sites were blocked with 1% BSA, the cells were incubated with an anti-AR antibody (Cat No. 66747-1-Ig; Proteintech, Wuhan, China) overnight at 4 °C. The following day, the cells were washed 3 times with PBS and incubated with a fluorescently labeled secondary antibody for 1 h. DAPI (Cat No. G1012; Servicebio) was used to stain nuclei, and immunofluorescence (IF) was observed using a fluorescence microscope.

Data analysis

GraphPad Prism 8.0 (GraphPad Prism, La Jolla, CA, USA) was used for statistical analysis, and all data were expressed as the mean ± standard deviation (SD). All assays were performed in triplicates unless otherwise mentioned. Differences between groups were analyzed using Student’s t‑test, whereas differences among three or more groups were analyzed using one-way analysis of variance (ANOVA). The association between USP36 expression and clinicopathological features (lymph node metastasis) or survival outcomes (Disease-Specific Survival and Progression-Free Interval) was analyzed using data from the TCGA prostate cancer (PRAD) cohort. A P value of < 0.05 indicated statistically significant differences.

Low doses of H₂O₂ increased viability and induced oxidative stress in PCa cells

To determine the optimal concentration of H₂O₂, we first evaluated its cytotoxic effects on PCa cells using the CCK8 assay. Treatment with low concentrations of H₂O₂ (5, 10, and 20 μM) enhanced cell viability in a concentration-dependent manner (Fig. 1A). In contrast, high concentrations of H₂O₂ (160 and 320 μM) led to a marked decline in viability (Fig. 1A). Based on these results, 10 and 20 μM H₂O₂ were selected for subsequent experiments. To examine whether prolonged oxidative stress further enhances cell viability, we extended H₂O₂ treatment to 48 h with replenishment at 24 h to maintain consistent stress levels. The results demonstrated that cell viability increased only marginally after 48 h compared to 24 h in both LNCaP and 22Rv1 cells (Fig. 1B), indicating that the pro-survival effect of low-dose H₂O₂ had largely reached a plateau by 24 h. To further determine whether H₂O₂ directly stimulates cell proliferation, we performed EdU incorporation assays. After 24 h of treatment, both LNCaP and 22Rv1 cells exhibited a significant, dose-dependent increase in the proportion of EdU-positive cells following exposure to 10 μM or 20 μM H₂O₂ (Fig. 1C). These results confirm that low-dose H₂O₂ actively promotes DNA synthesis and cell proliferation within 24 h, providing functional evidence that supports the CCK-8 viability data. Androgen deprivation therapy has been shown to trigger oxidative stress in PCa. This oxidative stress induces reactivation of AR, leading to the development of CRPC⁶. A study reported that downregulation of SOD2 directly reactivated AR by increasing ROS levels in CRPC cells⁸. In this study, we used H₂O₂ as an exogenous oxidant to simulate oxidative stress in PCa cells. Treatment with low concentrations of H₂O₂ significantly increased ROS levels (Fig. 1D). Collectively, these findings indicate that low-dose H₂O₂ induces oxidative stress and promotes viability in PCa cells.

H₂O₂ upregulates AR and activates PSA under both standard and castration-mimic conditions

AR is a member of the nuclear receptor superfamily and acts as a ligand-dependent nuclear transcription factor. PSA is one of the genes regulated by AR and is considered the most sensitive biomarker for prostate diseases, including PCa. Given the close relationship between ROS and reactivation of AR, we examined whether H₂O₂ exposure could upregulate the expression of AR and PSA. As shown in Fig. 2A, B, treatment with H₂O₂ increased the protein expression of AR and PSA in a dose-dependent manner. Furthermore, dual-luciferase reporter assay demonstrated that treatment with H₂O₂ enhanced the transcriptional activity of PSA promoter (Fig. 2C, D) possibly owing to the upregulation of AR. To further determine if oxidative stress can reactivate AR signaling under a clinically relevant, near-castration condition, we cultured cells in charcoal-stripped serum (CDT-FBS) supplemented with 0.5 nM DHT. Remarkably, H₂O₂ treatment still significantly increased the protein levels of both AR and PSA in this androgen-deprived setting (Fig. 2E–H), demonstrating that the reactivation of the AR-PSA axis by oxidative stress is effective even with minimal androgen support. To further validate the effect of H₂O₂ on AR signaling in a castration-resistant model endogenously expressing AR-V7, we performed Western blot analysis in 22RV1 cells. As shown in Fig. 2I, treatment with H₂O₂ markedly increased the protein levels of full-length AR (AR-FL) and its target PSA. Notably, the protein abundance of AR-V7 remained unchanged upon H₂O₂ exposure, suggesting that oxidative stress primarily activates canonical AR signaling through the full-length receptor rather than modulating the expression of this splice variant. Altogether, the results indicated that exposure to H₂O₂ activated the AR-PSA pathway in PCa cells.

To further investigate the interplay between oxidative stress and androgen signaling, we evaluated the effects of H₂O₂ alongside varying DHT concentrations. Low DHT (1–2 nM) significantly enhanced AR and PSA expression and cell viability (Fig. S1A–B, see supplementary material¹¹). To confirm the central role of AR in mediating H₂O₂ effects, we performed AR knockdown and antagonism experiments. siRNA-mediated AR knockdown decreased PSA expression and reduced viability in H₂O₂₋treated cells (Fig. S2A–D, see supplementary material¹¹). Similarly, the AR antagonist enzalutamide suppressed PSA expression and viability without affecting AR protein levels (Fig. S3A–D, see supplementary material¹¹). These results confirm that AR signaling is necessary for H₂O₂-induced growth promotion.

TurboID-mediated proximity biotin labeling revealed AR-interacting proteins upon H₂O₂ exposure

To investigate how H₂O₂ regulates AR expression, we employed TurboID-mediated proximity biotin labeling in LNCaP cells. Biotin labeling efficiency was high with or without H₂O₂ (Fig. 3A). Streptavidin pulldown and silver staining revealed distinct protein profiles between control and H₂O₂₋treated groups (Fig. 3B). Mass spectrometry identified 546 H₂O₂₋specific AR-interacting proteins (Fig. 3C, Table S1, see supplementary material¹²). GO analysis showed that these proteins were closely associated with “positive regulation of androgen receptor activity” and “proteasome-mediated ubiquitin-dependent protein catabolic process” (Fig. 3D, Table S2, see supplementary material¹²), suggesting H₂O₂ modulates AR via the ubiquitin–proteasome pathway. A total of 21 ubiquitination-associated proteins were found to interact with AR in H₂O₂₋treated PCa cells (Table S3, see supplementary material¹²). These proteins included USP36, an important deubiquitinating enzyme of the ubiquitin-specific protease (USP) family.

To assess the clinical relevance of USP36, we analyzed TCGA-PRAD data. High USP36 expression was significantly correlated with aggressive clinicopathological features (Fig. 3E–G). High USP36 expression was significantly associated with aggressive clinicopathological features. USP36 was markedly elevated in tumors with lymph node metastasis (Pathologic N1 stage) compared to non-metastatic (N0) and normal tissues (Fig. 3E). Moreover, patients with higher USP36 expression exhibited significantly poorer progression-free interval (PFI, Fig. 3F) and worse disease-specific survival (DSS, Fig. 3G). These findings from a large clinical cohort strongly support our in vitro data, positioning USP36 as a key driver of aggressive disease and a promising prognostic biomarker. USP36 has been shown to play an oncogenic role in multiple malignancies, including glioblastoma and esophageal squamous carcinoma. For instance, Chang et al. reported that USP36 contributed to the progression of glioblastoma by deubiquitinating and stabilizing ALKBH5¹³, whereas Zhang et al. demonstrated that USP36 aggravated esophageal squamous carcinoma by deubiquitinating and stabilizing YAP¹⁴. Therefore, we subsequently investigated whether H₂O₂ upregulated AR by promoting its interaction with USP36 in PCa cells.

USP36 overexpression enhanced AR stability

USP36 was overexpressed in PCa cells (Fig. 4A). While USP36 overexpression alone did not affect AR levels, it markedly enhanced AR protein expression in the presence of H₂O₂ (Fig. 4B, C), suggesting H₂O₂₋dependent regulation. Subsequently, the stability of AR protein was evaluated using cycloheximide (CHX) chase assay, in which CHX prevents protein synthesis to assess the degradation rate of existing proteins. Overexpression of USP36 resulted in increased stability of AR protein as evidenced by the higher protein expression of AR in the USP36 group than in the Vec group at all time points (Fig. 4D).

H₂O₂ inhibited AR ubiquitination via in a USP36-dependent manner​

Given that USP36 is a deubiquitinating enzyme, we hypothesized that USP36 stabilized AR protein via deubiquitination in the presence of H₂O₂. The binding between USP36 and AR was examined using Co-IP. Co-IP confirmed that H₂O₂ promotes interaction between exogenous (Fig. 5A) and endogenous (Fig. 5B) AR and USP36. The knockdown efficiency of shUSP36 was validated using western blotting (Fig. 5C). As shown in Fig. 5D, exposure to H₂O₂ prominently suppressed the ubiquitination of AR, whereas silencing of USP36 reversed this phenomenon, indicating that H₂O₂ stabilized AR protein through USP36. These results collectively indicated that exposure to H₂O₂ enhanced and stabilized AR expression through the deubiquitinating effects of USP36.

USP36 mediates H₂O₂₋induced activation of the AR-PSA pathway

We further investigated whether H₂O₂ could activate the AR–PSA pathway via USP36 in PCa. Western blotting showed that treatment with H₂O₂ increased the protein expression of AR and PSA, whereas silencing of USP36 counteracted this increase (Fig. 6A). Consistent with these results, IF assay showed that treatment with H₂O₂ increased the expression of AR, which was reversed by USP36 silencing (Fig. 6B, C). Consistent with protein-level changes, H₂O₂ upregulated PSA mRNA (KLK3) levels, whereas silencing of USP36 reversed this change (Fig. 6D). Treatment with H₂O₂ elevated the luciferase activity of PSA promoter, whereas silencing of USP36 counteracted this change (Fig. 6E), suggesting that H₂O₂ activated the transcription of PSA through USP36. Together, these results demonstrate that H₂O₂ stabilizes AR and activates PSA transcription through USP36.

Redox reactions function as a crucial second messengers in cancer cells and represent an emerging target for cancer therapy¹⁵. Oxidative stress promotes cancer cell survival, proliferation, and adaptation to hypoxic microenvironments⁵, and can activate multiple oncogenic signaling pathways, including MAPK, ERK1/2, and PI3K-AKT¹⁶. In PCa, oxidative stress plays an important role in both disease initiation and progression¹⁷. ADT has been shown to induce oxidative stress in PCa cells, leading to AR pathway activation through diverse mechanisms and ultimately contributing to the development of CRPC^6,18. For instance, Shiota et al. demonstrated that H₂O₂ up-regulated Twist1 and AR expression, while Twist1 knockdown attenuates H₂O₂₋induced AR elevation¹⁸. In addition, genetic polymorphisms in antioxidant enzymes have been linked to ADT response¹⁹, further supporting the role of oxidative stress in CRPC progression. Hormone deprivation disrupts cellular homeostasis, elevates ROS production, and increases oxidative stress, thereby driving CRPC development²⁰. A detailed understanding of the mechanisms by which oxidative stress activates AR signaling and promotes tumor progression is essential for developing novel therapeutic strategies for CRPC.

In this study, we observed that low-dose H₂O₂ (10 or 20 μM) enhanced cell viability and increased ROS levels in PCa cells. These concentrations were therefore selected to simulate oxidative stress in subsequent experiments. AR is a ligand-dependent transcription factor that, upon androgen binding, translocates to the nucleus and activates target genes transcription. PSA, a key AR-regulated gene, serves as a sensitive biomarker for PCa²¹. We found that H₂O₂ exposure markedly enhanced PSA transcription and protein expression, likely through upregulation of AR. It is noteworthy that in our experiments, the PSA protein was readily detectable in 22RV1 cells under baseline conditions, which appears to contrast with the established knowledge that it is normally hard to detect under standard conditions. We attribute this discrepancy primarily to the distinct molecular characteristics of the 22RV1 cell line. 22RV1 cells are a well-established model of CRPC, particularly known for expressing truncated, constitutively active androgen receptor splice variants, most notably AR-V7^22,23. AR-V7 lacks the ligand-binding domain, leading to its constitutive activation and ligand-independent transcription of AR target genes, including KLK3/PSA^23,24. The readily detectable basal PSA expression we observed is a hallmark of this AR-V7-driven, constitutively active signaling state inherent to the 22RV1 model. Our oxidative stress (H₂O₂) treatment served to further amplify this pre-existing signaling axis.

To investigate how H₂O₂ upregulates AR protein expression, we employed TurboID-mediated proximity biotin labeling and MS to identify AR-interacting proteins in H₂O₂₋stimulated LNCaP cells. LNCaP cells were used to assess interactions between AR and other proteins under hormone-dependent conditions so as to obtain key insights into the AR signaling pathway. However, it is noteworthy that the findings obtained from LNCaP cells cannot be directly applied to CRPC cells, such as 22RV1 cells, without parallel assays. GO analysis showed that the AR-interacting proteins identified from H₂O₂₋stimulated LNCaP cells, including USP36, were enriched in “proteasome-mediated ubiquitin-dependent protein catabolic process”. This finding suggested that H₂O₂ increased AR expression in PCa cells through the ubiquitin–proteasome pathway. Deubiquitinating enzymes stabilize proteins by removing ubiquitin from the proteins, thereby preventing the proteins from being degraded by proteasomes. The deubiquitinating enzyme USP36 promotes tumor progression by preventing the degradation of multiple proteins involved in tumorigenesis and inflammation²⁵. USP36 is markedly upregulated and acts as an oncogene in various malignancies, such as esophageal carcinoma¹⁴, glioblastoma²⁶, HCC²⁷, colorectal cancer²⁸, breast cancer²⁹, and T cell lymphoma³⁰. In this study, we found that endogenous USP36 could interact with endogenous AR in the presence of H₂O₂, leading to the deubiquitination and stabilization of AR. Furthermore, we found that H₂O₂ activated the AR–PSA pathway through USP36 in PCa cells. Both LNCaP and 22RV1 cells exhibited similar responses to oxidative stress, suggesting that AR–USP36 interaction induced by H₂O₂ was not limited to a specific PCa phenotype. These consistent findings highlight that oxidative stress plays an important role in AR signaling, potentially contributing to both hormone-responsive and castration-resistant prostate cancers.

Building upon the findings reported by de las Perez et al.³¹, who examined the impact of multi-DUB inhibition on AR, we investigated the specific mechanism of USP36 under oxidative stress. The results enhanced the understanding of AR regulation by highlighting the role of USP36 under oxidative stress. Unlike previous studies that broadly addressed the effects of DUB inhibition on AR, this study specifically showed that oxidative stress induces AR expression via USP36 in both hormone-responsive and castration-resistant PCa cells. Although we validated the interaction between USP36 and AR under oxidative stress, the precise mechanisms facilitating this interaction remain unclear. Future studies should focus on investigating the potential post-translational modifications of AR or USP36 and the resulting alterations in protein interactions and localization in response to oxidative stress. In addition, while our bioinformatic analysis of the TCGA cohort revealed a significant association between high USP36 expression and poor clinical outcomes, the precise biological mechanisms underlying this association remain to be fully elucidated beyond the AR stabilization pathway we identified in vitro.

In conclusion, our findings indicate that castration-induced oxidative stress activates the AR–PSA pathway via USP36-mediated deubiquitination and stabilization of AR, ultimately driving CRPC progression. Targeting castration-induced oxidative stress and the USP36-AR-PSA axis may therefore represent a promising therapeutic strategy for both hormone-sensitive and castration-resistant prostate cancer.

1. Liu, J. M., Chen, Y. T., Wu, C. T., Hsu, W. L. & Hsu, R. J. Androgen deprivation therapy for prostate cancer and the risk of thyroid diseases. Prostate 82(7), 809–815. https://doi.org/10.1002/pros.24323 (2022).

   Article  CAS  PubMed  Google Scholar 

2. Morote, J., Aguilar, A., Planas, J. & Trilla, E. Definition of castrate resistant prostate cancer: New insights. Biomedicines https://doi.org/10.3390/biomedicines10030689 (2022).

   Article  PubMed  PubMed Central  Google Scholar 

3. Scher, H. I. & Sawyers, C. L. Biology of progressive, castration-resistant prostate cancer: Directed therapies targeting the androgen-receptor signaling axis. J. Clin. Oncol. Off. J. Am. Soc. Clin. Oncol. 23(32), 8253–8261. https://doi.org/10.1200/jco.2005.03.4777 (2005).

   Article  CAS  Google Scholar 

4. Forman, H. J. & Zhang, H. Targeting oxidative stress in disease: promise and limitations of antioxidant therapy. Nat. Rev. Drug Discov. 20(9), 689–709. https://doi.org/10.1038/s41573-021-00233-1 (2021).

   Article  CAS  PubMed  PubMed Central  Google Scholar 

5. Jelic, M. D., Mandic, A. D., Maricic, S. M. & Srdjenovic, B. U. Oxidative stress and its role in cancer. J. Cancer Res.Ther. 17(1), 22–28. https://doi.org/10.4103/jcrt.JCRT_862_16 (2021).

   Article  CAS  PubMed  Google Scholar 

6. Shiota, M., Yokomizo, A. & Naito, S. Oxidative stress and androgen receptor signaling in the development and progression of castration-resistant prostate cancer. Free Radic. Biol. Med. 51(7), 1320–1328. https://doi.org/10.1016/j.freeradbiomed.2011.07.011 (2011).

   Article  CAS  PubMed  Google Scholar 

7. Feng, T. et al. TXNDC9 regulates oxidative stress-induced androgen receptor signaling to promote prostate cancer progression. Oncogene 39(2), 356–367. https://doi.org/10.1038/s41388-019-0991-3 (2020).

   Article  CAS  PubMed  Google Scholar 

8. Sharifi, N., Hurt, E. M., Thomas, S. B. & Farrar, W. L. Effects of manganese superoxide dismutase silencing on androgen receptor function and gene regulation: Implications for castration-resistant prostate cancer. Clin. Cancer Res. Off. J. Am. Assoc. Cancer Res. 14(19), 6073–6080. https://doi.org/10.1158/1078-0432.Ccr-08-0591 (2008).

   Article  CAS  Google Scholar 

9. Gonzalez-Menendez, P. et al. GLUT1 protects prostate cancer cells from glucose deprivation-induced oxidative stress. Redox Biol. 17, 112–127. https://doi.org/10.1016/j.redox.2018.03.017 (2018).

   Article  CAS  PubMed  PubMed Central  Google Scholar 

10. Livak, K. J. & Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25(4), 402–408. https://doi.org/10.1006/meth.2001.1262 (2001).

    Article  CAS  PubMed  Google Scholar 

11. Zhou, Bo. Supplementary figures. Figshare. Fig. https://doi.org/10.6084/m9.figshare.28407956.v1 (2025).

12. Zhou, Bo. Supplementary tables. Figshare. Dataset. https://doi.org/10.6084/m9.figshare.28407959.v1 (2025).

13. Chang, G. et al. USP36 promotes tumorigenesis and drug sensitivity of glioblastoma by deubiquitinating and stabilizing ALKBH5. Neuro. Oncol. 25(5), 841–853. https://doi.org/10.1093/neuonc/noac238 (2023).

    Article  CAS  PubMed  Google Scholar 

14. Zhang, W. et al. USP36 facilitates esophageal squamous carcinoma progression via stabilizing YAP. Cell Death Dis. 13(12), 1021. https://doi.org/10.1038/s41419-022-05474-5 (2022).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

15. Perillo, B. et al. ROS in cancer therapy: the bright side of the moon. Exp. Mol. Med. 52(2), 192–203. https://doi.org/10.1038/s12276-020-0384-2 (2020).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

16. Zhang, J. et al. ROS and ROS-Mediated cellular signaling. Oxid. Med. Cell. Longev. 2016, 4350965. https://doi.org/10.1155/2016/4350965 (2016).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

17. Mondal, D. et al. Oxidative stress and redox signaling in CRPC progression: therapeutic potential of clinically-tested Nrf2-activators. Cancer Drug Resist. 4(1), 96–124. https://doi.org/10.20517/cdr.2020.71 (2021).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

18. Shiota, M. et al. Castration resistance of prostate cancer cells caused by castration-induced oxidative stress through Twist1 and androgen receptor overexpression. Oncogene 29(2), 237–250. https://doi.org/10.1038/onc.2009.322 (2010).

    Article  CAS  PubMed  Google Scholar 

19. Shiota, M. et al. Gene polymorphisms in antioxidant enzymes correlate with the efficacy of androgen-deprivation therapy for prostate cancer with implications of oxidative stress. Ann. Oncol. Off. J. Eur. Soc. Med. Oncol. 28(3), 569–575. https://doi.org/10.1093/annonc/mdw646 (2017).

    Article  CAS  Google Scholar 

20. Bassey, I. E. et al. Impact of androgen deprivation on oxidative stress and antioxidant status in nigerian patients with prostate cancer undergoing androgen deprivation therapy. JCO. Glob. Oncol. 6, 1481–1489. https://doi.org/10.1200/go.20.00290 (2020).

    Article  PubMed  Google Scholar 

21. Attard, G., Cooper, C. S. & de Bono, J. S. Steroid hormone receptors in prostate cancer: A hard habit to break?. Cancer Cell 16(6), 458–462. https://doi.org/10.1016/j.ccr.2009.11.006 (2009).

    Article  CAS  PubMed  Google Scholar 

22. Khurana, N. et al. Multimodal actions of the phytochemical sulforaphane suppress both AR and AR-V7 in 22Rv1 cells: Advocating a potent pharmaceutical combination against castration-resistant prostate cancer. Oncol. Rep. 38(5), 2774–2786. https://doi.org/10.3892/or.2017.5932 (2017).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

23. Szafran, A. T. et al. High-content screening identifies Src family kinases as potential regulators of ar-v7 expression and androgen-independent cell growth. Prostate 77(1), 82–93. https://doi.org/10.1002/pros.23251 (2017).

    Article  CAS  PubMed  Google Scholar 

24. Djusberg, E. et al. High levels of the AR-V7 splice variant and co-amplification of the golgi protein coding YIPF6 in AR amplified prostate cancer bone metastases. Prostate 77(6), 625–638. https://doi.org/10.1002/pros.23307 (2017).

    Article  CAS  PubMed  Google Scholar 

25. Niu, M. Y. et al. The emerging role of ubiquitin-specific protease 36 (USP36) in cancer and beyond. Biomolecules https://doi.org/10.3390/biom14050572 (2024).

    Article  PubMed  PubMed Central  Google Scholar 

26. Qiu, W. et al. PRL1 promotes glioblastoma invasion and tumorigenesis via activating USP36-mediated snail2 deubiquitination. Front. Oncol. 11, 795633. https://doi.org/10.3389/fonc.2021.795633 (2021).

    Article  CAS  PubMed  Google Scholar 

27. Sun, W. et al. Gene signature and prognostic value of ubiquitin-specific proteases members in hepatocellular carcinoma and explored the immunological role of USP36. Front. Biosci. 27(6), 190. https://doi.org/10.31083/j.fbl2706190 (2022).

    Article  CAS  Google Scholar 

28. Ling, H. et al. CEP63 upregulates YAP1 to promote colorectal cancer progression through stabilizing RNA binding protein FXR1. Oncogene 41(39), 4433–4445. https://doi.org/10.1038/s41388-022-02439-y (2022).

    Article  CAS  PubMed  Google Scholar 

29. Wu, H. et al. miR-140–3p/usp36 axis mediates ubiquitination to regulate PKM2 and suppressed the malignant biological behavior of breast cancer through Warburg effect. Cell Cycle 22(6), 680–692. https://doi.org/10.1080/15384101.2022.2139554 (2023).

    Article  CAS  PubMed  Google Scholar 

30. Li, B. et al. MELK mediates the stability of EZH2 through site-specific phosphorylation in extranodal natural killer/T-cell lymphoma. Blood 134(23), 2046–2058. https://doi.org/10.1182/blood.2019000381 (2019).

    Article  PubMed  Google Scholar 

31. de Las, P. A., Reiner, T., De Cesare, V., Trost, M. & Perez-Stable, C. Inhibiting multiple deubiquitinases to reduce androgen receptor expression in prostate cancer cells. Sci. Rep. 8(1), 13146. https://doi.org/10.1038/s41598-018-31567-3 (2018).

    Article  ADS  CAS  Google Scholar 

Download references

Authors and Affiliations

1. Urology Department, The Second Affiliated Hospital of Zhengzhou University, Zhengzhou, 450014, People’s Republic of China

   Changhui Fan, Zhiheng Huang, Junfeng Gao, Yulong Gu & Ning Wang

2. Department of Center for Medical Experiment, The Second Affiliated Hospital of Zhengzhou University, 2 Jingba Road, Zhengzhou, 450014, Henan Province, People’s Republic of China

   Bo Zhou

Contributions

Changhui Fan developed the methodology, performed the experiment, and wrote the manuscript. Zhiheng Huang, Junfeng Gao contributed to the performance of experiments and prepared figures. Yulong Gu, Ning Wang mainly involved in the data analysis and prepared figures. Bo Zhou participated in the proposal of the conception, as well as manuscript review, and funding acquisition. All authors have read and approved the final manuscript.

Corresponding author

Correspondence to Bo Zhou.

Competing interests

The authors declare no competing interests.

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.

Reprints and permissions